control odn sequence 1982 (tccaggacttctctcaggtt) (Coley Pharmaceutical)
90
Structured Review
Coley Pharmaceutical
control odn sequence 1982 (tccaggacttctctcaggtt)
Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+sequence+1982+(tccaggacttctctcaggtt)/control+odn/pmc01064943-141-27-38
Average 90 stars, based on 1 article reviews
Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+sequence+1982+(tccaggacttctctcaggtt)/control+odn/pmc01064943-141-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 (tccaggacttctctcaggtt) - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
Sequencing:Article Title: A Live and Inactivated Chlamydia trachomatis Mouse Pneumonitis Strain Induces the Maturation of Dendritic Cells That Are Phenotypically and Immunologically Distinct Article Snippet: Hybridoma X63 producing IL-4 was provided by F. Melchers, Basilea Institute, Basel, Switzerland. .. Oligodeoxynucleotide (ODN) sequence 1826 ( 37 ) containing two cytosine phosphate guanosine (CpG) motifs (TCCATGA CG TTCCTGA CG TT; the underlined bases represent the CpG motifs) and Control:Article Title: A Live and Inactivated Chlamydia trachomatis Mouse Pneumonitis Strain Induces the Maturation of Dendritic Cells That Are Phenotypically and Immunologically Distinct Article Snippet: Hybridoma X63 producing IL-4 was provided by F. Melchers, Basilea Institute, Basel, Switzerland. .. Oligodeoxynucleotide (ODN) sequence 1826 ( 37 ) containing two cytosine phosphate guanosine (CpG) motifs (TCCATGA CG TTCCTGA CG TT; the underlined bases represent the CpG motifs) and |